Journal: bioRxiv

Article Title: Expanding the toolkit for genetic manipulation and discovery in Candida species using a CRISPR ribonucleoprotein-based approach

doi: 10.1101/2023.06.16.545382

Figure Lengend Snippet: The CRISPR-Cas9 RNP system using 130-150 bp homology regions efficiently generates ADE2 deletions in C. glabrata using NatMX and HphMX . (A) Schematic of pAG25 NatMX plasmid. P1 and P2 indicate location of amplification sequences. (B) Schematic of pAG32 HphMX plasmid. P1 and P2 indicate location of amplification sequences. (C) Representative transformation plate for ADE2 deletion using NatMX with and without addition of CRISPR-RNP. (D) Total number of positive transformants using NatMX with and without addition of CRISPR- RNP. Numbers represent the summation across three separate transformations. (E) Total number of positive transformants using HphMX with and without addition of CRISPR-RNP. Numbers represent the summation across three separate transformations.

Article Snippet: Custom Alt-R CRISPR gRNAs were designed and ordered from Integrated DNA Technologies ( ).

Techniques: CRISPR, Plasmid Preparation, Amplification, Transformation Assay

Journal: bioRxiv

Article Title: Expanding the toolkit for genetic manipulation and discovery in Candida species using a CRISPR ribonucleoprotein-based approach

doi: 10.1101/2023.06.16.545382

Figure Lengend Snippet: The CRISPR-Cas9 RNP system generates single and double gene deletions utilizing NatMX and HphMX in C. glabrata . (A and B) Five-fold serial dilution spot assays with and without 64 μg/mL fluconazole (FLZ). Indicated single deletion strains were generated using the CRISPR-Cas9 RNP method. Double deletion strains were generated using CRISPR-Cas9 RNP method sequentially and three independent clones are shown. Images were captured at 48 hours. (C and D) Expression of the indicated genes were determined by qRT-PCR analysis of mid-log phase cells. Data was normalized to RDN18 mRNA levels and are the average of three biological replicates with three technical replicates each. Error bars represent the standard deviation.

Article Snippet: Custom Alt-R CRISPR gRNAs were designed and ordered from Integrated DNA Technologies ( ).

Techniques: CRISPR, Serial Dilution, Generated, Clone Assay, Expressing, Quantitative RT-PCR, Standard Deviation

Journal: bioRxiv

Article Title: Expanding the toolkit for genetic manipulation and discovery in Candida species using a CRISPR ribonucleoprotein-based approach

doi: 10.1101/2023.06.16.545382

Figure Lengend Snippet: The CRISPR-Cas9 RNP system efficiently generates gene deletions utilizing BleMX in C. glabrata . (A) Schematic of pCY3090-07 plasmid. P1 and P2 indicate location of amplification primer sequences. (B) Total number of positive transformants using BleMX with and without addition of CRISPR-Cas9 RNP. Numbers are the summation across three separate transformations. (C) Five-fold serial dilution spot assays of indicated strains with and without 64 μg/mL fluconazole (FLZ). Two independent clones are shown for erg3Δ ( BleMX ). Images were captured at 48 hours.

Article Snippet: Custom Alt-R CRISPR gRNAs were designed and ordered from Integrated DNA Technologies ( ).

Techniques: CRISPR, Plasmid Preparation, Amplification, Serial Dilution, Clone Assay

Journal: bioRxiv

Article Title: Expanding the toolkit for genetic manipulation and discovery in Candida species using a CRISPR ribonucleoprotein-based approach

doi: 10.1101/2023.06.16.545382

Figure Lengend Snippet: The CRISPR-RNP system efficiently generates gene deletions utilizing KanMX for C. glabrata . (A) Schematic of pUG6 plasmid. P1 and P2 indicate location of amplification primer sequences. (B) Total number of positive transformants using KanMX with and without addition of CRISPR-RNP. Numbers are the summation across three separate transformations. (C) Five- fold serial dilution spot assays of indicated strains with and without 64 μg/mL fluconazole (FLZ). Images were captured at 48 hours.

Article Snippet: Custom Alt-R CRISPR gRNAs were designed and ordered from Integrated DNA Technologies ( ).

Techniques: CRISPR, Plasmid Preparation, Amplification, Serial Dilution

Journal: bioRxiv

Article Title: Expanding the toolkit for genetic manipulation and discovery in Candida species using a CRISPR ribonucleoprotein-based approach

doi: 10.1101/2023.06.16.545382

Figure Lengend Snippet: The CRISPR-Cas9 RNP system generates endogenous epitope tagged proteins using KanMX in C. glabrata . (A) Schematic of pFA6-3HA-KanMX plasmid. P1 and P2 indicate location of amplification primer sequences. (B and C) Indicated strains were either untreated (-) or treated (+) with 64 μg/mL of fluconazole (FLZ) for three hours. Whole cell extracts were isolated and immunoblotted against HA antibody for detection of Erg3 or Erg11. Histone H3 was used as a loading control. Three independent clones were represented for Erg3-3xHA and Erg11-3xHA. (D and E) Five-fold serial dilution spot assays of indicated strains with 0, 16, and 64 μg/mL fluconazole (FLZ), respectively. Three independent clones were represented for Erg3-3xHA and Erg11-3xHA. Images were captured at 48 hours.

Article Snippet: Custom Alt-R CRISPR gRNAs were designed and ordered from Integrated DNA Technologies ( ).

Techniques: CRISPR, Plasmid Preparation, Amplification, Isolation, Control, Clone Assay, Serial Dilution

Journal: bioRxiv

Article Title: Expanding the toolkit for genetic manipulation and discovery in Candida species using a CRISPR ribonucleoprotein-based approach

doi: 10.1101/2023.06.16.545382

Figure Lengend Snippet: The CRISPR-Cas9 RNP system generates gene deletions using a codon optimized BleMX in C. auris . (A) Schematic of pCdOpt-BMX plasmid. P1 and P2 indicate location of amplification primer sequences. (B) Five-fold serial dilution spot assays of indicated C. auris strains with and without 64 μg/mL fluconazole (FLZ). Four independent clones were represented for Caurerg3Δ strain ( BleMX ). Images were captured at 48 hours.

Article Snippet: Custom Alt-R CRISPR gRNAs were designed and ordered from Integrated DNA Technologies ( ).

Techniques: CRISPR, Plasmid Preparation, Amplification, Serial Dilution, Clone Assay

Journal: bioRxiv

Article Title: Expanding the toolkit for genetic manipulation and discovery in Candida species using a CRISPR ribonucleoprotein-based approach

doi: 10.1101/2023.06.16.545382

Figure Lengend Snippet: The CRISPR-Cas9 RNP system is used for deleting SET1 in C. albicans . (A) Schematic of pBSS2- SAT1- FLP plasmid. P1 and P2 indicate location of amplification primer sequences. (B) Whole cell extracts were isolated from indicated C. albicans strain SC5314 and immunoblotted against methyl-specific H3K4 mono-, di- and trimethylation antibodies. Histone H3 was used as a loading control. (C) Five-fold serial dilution spot assays of indicated C. albicans strains with and without 0.5 µg/mL fluconazole (FLZ). Images were captured at 24 hours.

Article Snippet: Custom Alt-R CRISPR gRNAs were designed and ordered from Integrated DNA Technologies ( ).

Techniques: CRISPR, Plasmid Preparation, Amplification, Isolation, Control, Serial Dilution

Journal: Cell host & microbe

Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

doi: 10.1016/j.chom.2018.05.006

Figure Lengend Snippet: (A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and Ap2a2-HA tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.

Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

Techniques: Construct, Y2H Assay, Activity Assay, Positive Control, Transfection, Staining, Immunoprecipitation

Journal: Cell host & microbe

Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

doi: 10.1016/j.chom.2018.05.006

Figure Lengend Snippet: (A) The intracellular growth of the wild type 10403S strain and the L. monocytogenes-LLO L461T strain in BMMs with the CRISPR/Cas9-mediated Ap2a2 knockout and sgRNA control BMMs. 50μg/ml gentamicin was added after 1h to kill extracellular bacteria. Results shown represent at least 3 independent experiments. (B) Schematic of hlyfl L. monocytogenes strain. The hly and tetL (tetracycline resistance) genes are flanked by loxP sites. Cre recombinase is expressed from the cytosol-specific actA promoter. Recombination between loxP sites leads to the excision of the DNA encoding hly and tetL. (C) Intracellular growth of the hlyfl L. monocytogenes strain in Ap2a2 knockout and control BMMs. 50μg/ml gentamicin was added to kill extracellular L. monocytogenes. Results are representative of at least 3 independent experiments. (D) Flow cytometry analysis of SYTOX Blue staining of control and Ap2a2 knockdown BMM infected for 8 hours with an effective MOI of 1. Positively stained cells resulted from the loss of plasma membrane integrity. No gentamicin was added for plasma membrane integrity assay. ** p<0.01, *** p<0.001 (Student’s t-test). Results shown represent 2 independent experiments. See also Figure S4.

Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

Techniques: CRISPR, Knock-Out, Control, Bacteria, Flow Cytometry, Staining, Knockdown, Infection, Clinical Proteomics, Membrane, Integrity Assay

Journal: Cell host & microbe

Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

doi: 10.1016/j.chom.2018.05.006

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

Techniques: Virus, Recombinant, Staining, Flow Cytometry, Modification, Lysis, Transfection, Immunoprecipitation, Plasmid Preparation, CRISPR, Software, Microscopy

Journal: Molecular Medicine

Article Title: NNAT is a novel mediator of oxidative stress that suppresses ER + breast cancer

doi: 10.1186/s10020-023-00673-y

Figure Lengend Snippet: Reactive oxygen and calcium related genes behavior comparison between NNAT overexpression ER + breast cancer cells lines (T47D and ZR75) vs. poor prognosis tumorigenesis in clinical reports. Opposite expression patterns marked in bold

Article Snippet: T47D and ZR75 cells overexpressing GFP, NNAT, pLentiCRISPRv2 empty vector control (CRISPR control) or NNAT CRISPR Guide RNA3 (GenScript) (n = 3 plates per group; 20k cells/well) were seeded on glass bottom culture dishes.

Techniques: Comparison, Over Expression, Expressing

Journal: Molecular Medicine

Article Title: NNAT is a novel mediator of oxidative stress that suppresses ER + breast cancer

doi: 10.1186/s10020-023-00673-y

Figure Lengend Snippet: NNAT mRNA expression is regulated by oxidative stress and activation of PPAR signaling cascade. A Luminescence activity of NNAT promoter activity co-transfected with E2F1, E2F4, NRF1, PPARα + RXR, PPARγ + RXR, or pLX304 control plasmid in ER + breast cancer cell lines. Data presented as mean percentage of GLuc/SEAP ratio normalized to pLX304 ± SEM (n = 9 per group; paired t-test, ***p < 0.001 vs. pLX304 control). B Evaluation of mRNA expression of NNAT, tumor suppressors genes CDKN1A and CDKN2B, and the transcription factor NRF1 responsible for cellular growth, during the exposure to H 2 O 2 . MCF10A, MDA-MB-231, T47D, and ZR75 cell lines untreated or treated with H 2 O 2 (n = 3 per group; paired t-test, *p < 0.05, **p < 0.01, ***p < 0.001 vs. control). C NNAT mRNA expression of MCF10A, MDA-MB-231, T47D, and ZR75 cells treated with or without PPAR agonist, Clofibrate (n = 3 per group; paired t-test, *p < 0.05, **p < 0.01 vs. untreated control)

Article Snippet: T47D and ZR75 cells overexpressing GFP, NNAT, pLentiCRISPRv2 empty vector control (CRISPR control) or NNAT CRISPR Guide RNA3 (GenScript) (n = 3 plates per group; 20k cells/well) were seeded on glass bottom culture dishes.

Techniques: Expressing, Activation Assay, Activity Assay, Transfection, Control, Plasmid Preparation

Journal: Molecular Medicine

Article Title: NNAT is a novel mediator of oxidative stress that suppresses ER + breast cancer

doi: 10.1186/s10020-023-00673-y

Figure Lengend Snippet: NNAT regulates intracellular calcium in ER + breast cancer cells through EndoR calcium storage. A Confocal fluorescent imaging revealed NNAT (green) colocalization with EndoR and lysosome (red and yellow merged images). B Basal Ca 2+ concentration in T47D and ZR75 CRISPR knockout of NNAT cell lines (NNAT CRISPR) (n = 30 per group, paired t-test, p < 0.001 vs. control). C EndoR Ca 2+ release following knockout of NNAT (n ≥ 16 per group; paired t-test, **p < 0.01 vs. respective CRISPR control). D Basal Ca 2+ concentration in T47D and ZR75 cell lines overexpressing NNAT (n = 30 per group, paired t-test, p < 0.001 vs. control). E Change in proliferative capacity in T47D and ZR75 breast cancer cell lines overexpressed NNAT deletion construct (wild-type, NNAT, and dER). (n = 9 per group; one-way ANOVA tests (Tukey post hoc test) *p < 0.05, ***p < 0.001 vs. GFP).

Article Snippet: T47D and ZR75 cells overexpressing GFP, NNAT, pLentiCRISPRv2 empty vector control (CRISPR control) or NNAT CRISPR Guide RNA3 (GenScript) (n = 3 plates per group; 20k cells/well) were seeded on glass bottom culture dishes.

Techniques: Imaging, Concentration Assay, CRISPR, Knock-Out, Control, Construct

Journal: Molecular Medicine

Article Title: NNAT is a novel mediator of oxidative stress that suppresses ER + breast cancer

doi: 10.1186/s10020-023-00673-y

Figure Lengend Snippet: ORAI but not TRPC3 inhibition reduces NNAT-mediated elevation in intracellular Ca 2+ concentration in breast cancer cells. The overexpression of NNAT promotes significantly higher Ca 2+ release from EndoR of ZR75 breast cancer cells. (n = 30 per group; paired t-test, ***p < 0.001 vs. control GFP) ( A ). Intracellular Ca 2+ levels in standard and overexpressing NNAT T47D and ZR75 cell lines in the presence or absence of ORAI (pyr6) ( B ) or TRPC3 (pyr3) ( C ) pyrazole compound inhibitors (n = 30 per group; Two-way ANOVA tests (factors: NNAT and inhibitor; Tukey post hoc test) ***p < 0.001)

Article Snippet: T47D and ZR75 cells overexpressing GFP, NNAT, pLentiCRISPRv2 empty vector control (CRISPR control) or NNAT CRISPR Guide RNA3 (GenScript) (n = 3 plates per group; 20k cells/well) were seeded on glass bottom culture dishes.

Techniques: Inhibition, Concentration Assay, Over Expression, Control