Journal: Frontiers in Immunology

Article Title: Modeling the Function of TATA Box Binding Protein in Transcriptional Changes Induced by HIV-1 Tat in Innate Immune Cells and the Effect of Methamphetamine Exposure

doi: 10.3389/fimmu.2018.03110

Figure Lengend Snippet: Generation of a TBP-deficient THP1 clone. (A) Seventy-two hours after exposure to gesicles containing the TBP guide sequence and Cas9, positively transfected cells were visualized under a fluorescence-microscope for detection of intracellular red fluorescence signal originated from the Cherry Picker reporter on the gesicles' surface. Positive control provided by the manufacturer was compared with a negative control performed with empty gesicles, and two clones that received the guide sequence. Clone 1A showed low efficiency, and clone 2A was highly positive. (B) The Cherry Picker-positive cells were gated based on fluorescence intensity, and sorted using a BD FACSJazz (BD Biosciences, San Diego, CA). (C) The TBP mutation was confirmed in clone 2A using DNA hybridization with Guide-It Resolvase on a gel-purified genomic TBP sequence, and with (D) qRT-PCR. Results are the average ± standard error of 2 experiments performed in triplicate.

Article Snippet: For that, we used the CRISPR/Cas9 gesicle technology , with Guide-It CRISPR/Cas9 gesicle system (Clontech, Mountain View, CA).

Techniques: Sequencing, Transfection, Fluorescence, Microscopy, Positive Control, Negative Control, Clone Assay, Mutagenesis, DNA Hybridization, Purification, Quantitative RT-PCR

Journal: bioRxiv

Article Title: Microglia ferroptosis is prevalent in neurodegenerative disease and regulated by SEC24B

doi: 10.1101/2021.11.02.466996

Figure Lengend Snippet: (A) Schema for positive selection Genome-wide CRISPR screen in Cas9-expressing human immortalized microglia. (B) Venn diagrams for hits from each viral pool in 8hr and 24hr treatments. (C) Overlapping hits from each viral pool with number of gRNAs identified in 8hr and 24hr treatment with SEC24B and ACSL4 highlighted. (D) qRT-PCR analysis showing markedly reduce expression of SEC24B in KO line (n=3). Unpaired t test. *p<0.05. Error bars represent SEM. (E) Western blot showing absence of SEC24B protein in KO line. (F) Death kinetics in SEC24B KO Hap1 cell line and isogenic control (n=3). AUC, one-way ANOVA, Dunnett post hoc. ****p<0.0001. Error bars represent SEM.

Article Snippet: The sgRNA sequences were amplified using Guide-it™ CRISPR Genome-Wide Library PCR Kit (Takara, 632651) and subjected to the high-throughput amplicon sequencing on NextSeq500.

Techniques: Selection, Genome Wide, CRISPR, Expressing, Quantitative RT-PCR, Western Blot

Journal: Cell host & microbe

Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

doi: 10.1016/j.chom.2018.05.006

Figure Lengend Snippet: (A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and Ap2a2-HA tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.

Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

Techniques: Construct, Y2H Assay, Activity Assay, Positive Control, Transfection, Staining, Immunoprecipitation

Journal: Cell host & microbe

Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

doi: 10.1016/j.chom.2018.05.006

Figure Lengend Snippet: (A) The intracellular growth of the wild type 10403S strain and the L. monocytogenes-LLO L461T strain in BMMs with the CRISPR/Cas9-mediated Ap2a2 knockout and sgRNA control BMMs. 50μg/ml gentamicin was added after 1h to kill extracellular bacteria. Results shown represent at least 3 independent experiments. (B) Schematic of hlyfl L. monocytogenes strain. The hly and tetL (tetracycline resistance) genes are flanked by loxP sites. Cre recombinase is expressed from the cytosol-specific actA promoter. Recombination between loxP sites leads to the excision of the DNA encoding hly and tetL. (C) Intracellular growth of the hlyfl L. monocytogenes strain in Ap2a2 knockout and control BMMs. 50μg/ml gentamicin was added to kill extracellular L. monocytogenes. Results are representative of at least 3 independent experiments. (D) Flow cytometry analysis of SYTOX Blue staining of control and Ap2a2 knockdown BMM infected for 8 hours with an effective MOI of 1. Positively stained cells resulted from the loss of plasma membrane integrity. No gentamicin was added for plasma membrane integrity assay. ** p<0.01, *** p<0.001 (Student’s t-test). Results shown represent 2 independent experiments. See also Figure S4.

Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

Techniques: CRISPR, Knock-Out, Control, Bacteria, Flow Cytometry, Staining, Knockdown, Infection, Clinical Proteomics, Membrane, Integrity Assay

Journal: Cell host & microbe

Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

doi: 10.1016/j.chom.2018.05.006

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

Techniques: Virus, Recombinant, Staining, Flow Cytometry, Modification, Lysis, Transfection, Immunoprecipitation, Plasmid Preparation, CRISPR, Software, Microscopy